DNA extraction and amplification of the rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) gene of red seaweed Gracilaria sp. from Bahoi Waters, North Minahasa Regency
DOI:
https://doi.org/10.35800/jasm.6.2.2018.24836Keywords:
DNA, gene rbcL, red algae, Gracilaria sp., minahasa regencyAbstract
Title (Bahasa Indonesia): Ekstraksi DNA dan Amplifikasi gen rbcL(ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) Alga Merah Gracilaria sp. dari Perairan Desa Bahoi, Kabupaten Minahasa Utara
Â
The quality of DNA extraction and gene amplification in algae are influenced by several factors includingthe characters and components of the algal cell wall. Therefore, extraction procedure that successfully works in one species of algae mayfail for another type of algae.  The present study was aimed to examine several DNA extraction techniquesand rbcL (ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit)gene amplifications of Gracilaria sp. collected inBahoi, North Minahasa (126043’48’’N 12501’33â€E). DNA genom of Gracilariasp. was extracted using conventional method (CTAB, Cetyltrimethyl ammonium Bromide), and commercial extraction kits (innuPrep Plant DNA Kit and Geneaid Genomic Plant Mini Kit). Amplification of rbcLgene employed 2 primers (rbcL-aF; ATGTCACCACAAACAGAGACTA AAGC, rbcL-aR; GTAAAATC-AAGT CCACCRCG, and rbcL-1F ATGTCACCACAAACAGAAAC, rbcL-724R TCGCATGTA-CC TGCAGTAGC under 2 different annealing temperatures (45 and 500C). Genomic DNA of Gracilariasp. was successfully extracted using Geneaid DNA Mini Kit (Plant) indicated by a DNA band on the agarose gel. RbcLgene of Gracilaria sp. could be amplified using primer 1F-724R and annealing temperature at 500C indicated bya sharp DNA band at 300-400 bp (1kb marker, Solis Biodyne) as a partial amplification of the target gene.
Kualitas hasil ekstraksi DNA dan amplifikasi gen pada alga dipengaruhi oleh beberapa faktor diantaranya adalah karakter dan komponen penyususun dinding sel alga itu sendiri. Oleh karena itu, prosedur ekstraksi yang berhasil dilakukan pada pada satu jenis alga dapat saja gagal dilakukan untuk jenis alga lainnya.  Penelitian ini dilakukan untuk mengkaji beberapa teknik ekstraksi DNA dan kondisi amplifikasi gen rbcL(ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit) pada alga jenis Gracilariasp. dari perairan Bahoi, Minahasa Utara (126043’48’’N 12501’33â€E).  Ekstraksi DNA Gracilaria sp. dilakukan menggunakan metode konvensional (CTAB, Cetyltrimethyl ammonium Bromide), dan menggunakan kit ekstraksi komersil (innuPrep Plant DNA Kitdan Geneaid Genomic Plant Mini Kit). Amplifikasi gen rbcLdilakukkan menggunakan 2 pasang primer (rbcL-aF; ATGTCACCACAAACAGAGACTA AAGC, rbcL-aR; GTAAAATCAAGTCCACCRCG, dan rbcL-1F ATGTCACCACA AACAGAAAC, rbcL-724R TCGCATGTACCTGCAGTAGC dan 2 kondisi suhu annealingberbeda(45 dan 500C). DNA genom alga (Gracilariasp.) dapat diekstraksi menggunakan prosedur Geneaid DNA Mini Kit (Plant) yang ditandai adanya pita DNA pada gel agarose. Gen rbcLof Gracilaria sp. dapat diamplifikasi menggunakan pasangan primer rbcL1F dan 724R pada suhu annealing 500C yang ditandai dengan adanya pita DNA tebal pada posisi sekitar 300-400 bp (1kb marker, Solis Biodyne).  Munculnya pita DNA target pada posisi tersebut mengindikasikan keberhasilan amplifikasi gen target secara parsial.
References
ALMEIDA, C.L.F., FALCAO, H.D., LIMA, G.R. D., MONTENEGRO, C.D., LIRA, N.S. and DE ATHAYDE, P.F. (2011) Bioactivities from marine algae of the genus Gracilaria. International Journal of Molecular Sciences, 12(7), 4550-4573.
AMANULLAH, T.R., KRISHNAN, D., BALAJI, S.D. and GANESAN, K. (2013) Effective production of ethanol-from-cellulose (EFC) from cheap sources sawdust and seaweed Gracilaria edulis. Advances in Applied Science Research, 4(5), 213-222.
ARIZO, M.A.M., BERONCAL, R.A.G. and CHUA, W.A.K.T. (2016) Immune response of Macrobrachium rosenbergii immersed in aqueous extract of Gracilaria edulis challenged with white spot syndrome virus. AACL Bioflux, 9(2).
BELORIN, A.M., OLIVEIRA, M.C. and OLIVEIRA, E.C. (2002) Phylogeny and sys-tematics of the marine algal family Gracilariaceae (Gracilariales, Rhodophyta) based on SSU rDNA and ITS sequences of Atlantic and Pacific species. Journal of Phycology, 38, 551-563.
DESTOMBE, C.I. and DOUGLAS, S.E. (1991) Rubisco Spacer Sequence Divergence in the Rhodophyte Alga Gracilaria Verrucosa and Closely Related Species. Curr. Genet. (5), 395-8.
DOYLE, J.J. and DOYLE, J. (1990) Isolation of plant DNA from fresh tissue. Focus, 12:13.
DOYLE, J.J. and DOYLE, J.L. (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull.
FAY, M.F., SWENSEN, S.M. and CHASE, M.W. (1997) Taxonomic affinities of Medusagyne oppositifolia (Medusagynaceae). Springer.
FRESHWATER, D.W., FREDERICQ, S., BUTLER, B.S, HOMMERSAND, M.H. and CHASE, M.W. (1994) A Gene Phylogeny Of The Red Algae (Rhodophyta) based on Plastid rbcL. Proc. Natl. Acad. Sci. USA 91, 7281-7285.
GERALDINO, J.P., CHANG, Y.E. and KIM, M.S. (2009) Systematics of Hypnea asiatica sp. nov. (Hypneaceae, Rhodophyta) Based on Morphology and nrDNA SSU, Plastid rbcL, and Mitochondrial Cox1. Taxon, 58(2), 606-616.
GERUNG, S.G. (2004) Biodiversity of Indonesian seaweeds. In: Marine Science into the New Millennium: New Perspective & Challenges. Phang, S.M., Chong, V.C., Ho, S.C., Mokhtar, N. and Sim, J.O.L. pp. 41-54.
GURGEL, C.F.D., LIAO, L.M., FREDERICQ, S. and HOMMERSAND, M.H. (2003) Systematics of Gracilariopsis (Gracilariales, Rhodophyta) based on rbcL Sequence Analyses and Morphological Evidence. Journal of Phycology, 39, 154-171.
HONG, Y., KIM, S., POLNE-FULLER, M., GIBOR, A. (1997) DNA extraction conditions from Porphyra perforata using LiCI. Journal of Applied Phycology, 7, 101-107.
IYER, R., DE CLERCK, O., BOLTON, J.J. and COYNE, V.E. (2004) Morphological and taxonomic studies of Gracilaria and Gracilariopsis species (Gracilariales, Rhodophyta) from South Africa. South African Journal of Botany, 70(4), 521-539.
KIM, K.M., IL, K.H. and YOON, H.S. (2012) Four novel Gelidium species (Gelidiales, Rhodophyta) discovered in Korea: G. coreanum, G. jejuensis, G. minimum and G. prostratum. Phycologia, 51.
LYRA, G. M., COSTA, E.S., DE JESUS P.B., DE MATOS, J.C.G. and CAIRES, T.A. (2015) Phylogeny Of Gracilariaceae (Rhodophyta): Evidence from Plastid and Mitochondrial Nucleotide Sequences. Journal of Phycology, 51, 356-366.
MANINGAS, M.B.B., GONZALEZ, P.G. and OBIAS, M.M. (2013) Immune response of Macrobrachium rosenbergii immersed in hot-water extract of Gracilaria edulis. Philippine Science Letters, 6(2).
MARINHO-SORIANO, E. and BOURRET, E. (2005). Polysaccharides from the red seaweed Gracilaria dura (Gracilariales, Rhodophyta). Bioresource Technology, 96(3), 379-382.
OYIEKE, H.A. and KOKWARO, J.O. (1995) Distribution and ecology of Gracilaria species (Gracilariales, Rhodophyta) along the Kenyan Coast. South African Journal of Marine Science, 15(1), 43-48.
PHILLIPS, N., SMITH, C.M., MORDEN, C.W. (2001) An effective DNA extraction protocol for Brown Algae. Phycological Research, 49, 97-102.
RAHAYU, D.A. and NUGROHO, E.D. (2015) Biologi Molekuler dalam Perspektif Konservasi. Plantaxia.
RUENES, J. (2010) DNA barcoding of Select Freshwater and Marine Red Algae (Rhodophyta). Cryptogamie, Algologie, 31 (4), 377-386.
RYCHLIK, W., SPENCER, W.J. and RHOADS, R.E. (1990) Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Research, 18(21).
SAHRI, A. and SUPARMI. (2009) Mengenal Potensi Alga : Kajian Pemanfaatan Sumber Daya Alga Dari Aspek Industri Dan Kesehatan. Sultan Agung, XLIV(118).
SAHU, N. and SAHOO, D. (2013) Study of Morphology and agar contents in some important Gracilaria species of Indian Coasts. American Journal of Plant Sciences, 4, 52-59.
TAN, J. (2013) Molecular Studies of Kappaphycus Doty and Eucheuma J. Agardh: Phylogenetics and DNA Barcode Assess-ment. Thesis. Kuala Lumpur: Institute of Biological Sciences Faculty of Science University of Malaya.
TUNEY, I. and SUKATAR, A. (2010) DNA extraction protocol from Brown Algae. Biological Diversity and Conservation.
URIA, A. (2013) Investigating Natural Product Biosynthesis in Uncultivated Symbiotic Bacteria of the Marine Sponge Theonella swinhoei. Disertation. Bonn: Universitat Bonn.
VINOBABA, P., KUMUDU and UMAKAN-THAN, G. (2016) Distribution of Gracillaria species (Gracillaria edulis, Rhodophyta) in SriLanka. Researcher, 8(6), 50-58.
WATTIER, R.A., PRODOHL, P.A. and MAGGS, C.A (2000) DNA Isolation Protocol for Red Seaweed (Rhodophyta). Plant Molecular Biology Reporter, 18, 275-281.
YANG, E.C., KIM, M.S., GERALDINO, P.J.L., SAHOO, D., SHIN, J. and BOO, S.M. (2013) Mitochondrial cox1 and Plastid rbcL Genes of Gracilaria vermiculophylla (Gracilaria-ceae, Rhodophyta). Journal of Applied Phycology, 20, 161-168.
Downloads
Published
Issue
Section
License
COPYRIGHT & LICENSES:
Authors retain copyright and grant the journal right of first publication with the work simultaneously licensed under an Attribution 4.0 International (CC BY 4.0) that allows others to share — copy and redistribute the material in any medium or format — and adapt — remix, transform, and build upon the material for any purpose, even commercially — with an acknowledgment of the work's authorship and initial publication in this journal.
This work is licensed under a Creative Commons Attribution 4.0 International License.
